Bersama Taklukan Dunia" lagu ini bercerita tentang sebuah bersahabtan yang selamanya akan bersama menghadapi dunia C G Am G teringat kembali satu permainan F C Dm G yang sering dirimu dan aku mainkan C G Am G raihlah tanganku, genggam jabat erat
menaribersama, tertawa ceria Am G dan ku kembali demi masa lalu Dm G kawan sejati takkan pernah pergi Reff : C G Am jangan ragu kawanku tuk singgahi tempat ini F G C menyanyikan lagu kesenangan sepenuh hati C G Am berdua kita lewati jalan yang terjal berlubang F G C bersama kita taklukkan dunia hari-hari bahagia, senyum lepas dan tawa
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNNNNNNNNNNNNNNNNNNNNCNNNANNNNNFNNNNNNNNNNNBNNFNNNANNNNNCNNNNNNBNNNNNNGNNFNNNNNNNNNAmNNDNNNNNNBNNCNNNGNNNNNNNBNNNNGmNNNNNNNNNCNNNNNNFNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNDmNNNNNNCNNFNNNNNNNNNNNNNNCNNNNNNNFNNNNNNNNNNNNNNNNNNNDmNNNNNNCNNFNNNNNNNNNNNNNNNNNNNNNNNNNNBNNNNNNNFNNNNBNNNNNNDmNNNNNNNFNNNNGmNNNNNNNNNNNNNGNNNNNNNNNCNNNNNNNNNFNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNDmNNNNNNFNNNNNNNNNNNNNNNGNNNDNNBNNDmNNNCNNNNNFNNNNNNGNNNNNNBNNGNNCNNNGNNFNNNNNNGNNNNNBNNNNNNCNNNNNNBNNFNNNNNNNNNNNNNNNNNNNNNNBNNNNNNCNNDmNNNBNNNNNFNNNNNNNNNNNNNNCNNNNBNNNFNNNNNNNNNNNNNNNNNNNDmNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login RocketRockers - Bersama kita taklukan dunia chords ver. 1 Autoscroll 1 Column Text size Transpose 0 t eringat k embali satu per mainan ya ng sering dirimu dan aku mainkan ra ihlah tanga nku, gen ggam jaba t erat m enari ber sama, te rtawa ce ria da n ku kembali demi mas a lalu kawan sejati takkan p ernah pergi Reff : album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose EEEDmEAEEEEEGmEEEEECmEEEEEEDmEEGEEEEFEEEEEEEDEEEEEEEFEEEBEAmEGEEEBEEEGEEEBEEEGEEEBECEEEFEEEEEEEEEEEEEEEEEEEDmEEECEFEEEBEFEECEEEFEEEEEEEEEEEDEEECEFEEEEEEEEEEEDmEFEEBEEEFEEEEBEDmEEEEEBEGEEEEBEEGEEEEECEEEEFEEEEEEEEEEEEEEEEEEEDmEEECEFEEEEEEEGEEEBEFEECEEFEEEGEEEBEEECEEEFEEEGEEBEEECEEEEBEFECEFEBEFECFEEEEECEDmEBECEFEEEEEEECEEEBEFEEEEEEEEEEEEDmEEECEFEEEEECEBEEEEEEEEEEEEEN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to LoginChordGitar Radja Tulus Intro] C Am F G (2x) [Verse 1] C Am Kekasih aku tak mengerti Dm G Apa yang ada didalam hatimu Dm G Kau diam, kau tersenyum padaku G Disaat ku salah [Verse 2] C Am Jangan pernah dustai hati Dm G Bila memang sudah tak cinta lagialbum Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNNNANNNNNFNNNNNNNNNNNNNNNNNNANNNNNCNNNNNNBNNNNNNGNNFNNNNNNNNNAmNNNNNNDmNNBNNCNNNGNNNNNNNBNNNNGNNNNNNFNNCNNNNNNFNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNDmNNNNNNCNNFNNNNNNNNNNNNNNCNNNNNNNFNNNNNNNNNNNNNNNNNNNDmNNNNNNCNNFNNNNNNNNNNNNNNNNNNNNNNNNNNBNNNNNNFNNNNNNNNNBNNDmNNNNNNNFNNNNGNNNNNNNNBNNNNGNNNNNNNNNCNNNNNNNNNFNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNDmNNNNNNFNNNNNNNNNNNNNNNGNNNDNNBNNDmNNNCNNNNNFNNNNNNGNNNNNNBNNNNNCNNNNNNFNNNNNNGNNNNNBNNNNNNNNCNNNNBNNFNNNNNNNNNNNNNNNNNNNNNNBNNNNNNCNNDmNNNNNNCNNFNNNNNNNNNNNNNNCNNNNBNNNFNNNNNNNNNNNNNNNNNNNDmNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login KunciGitar Rocket Rockers - DIA Chord Dasar Transpose: Auto Scroll Intro : C F Am G .. C tak pernah ada jalan keluar F Am di saat kita berbeda pendapat G jalan untuk ku temui.. C dan kini dia pun pergi menghilang F Am di saat aku akan mencoba G untuk lebih saling mengerti.. C tak akan ada yang lainnya F tak akan mungkin tergantikan Am G
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCFmCCCCCACFCCCCCCCCCCCCFCCCCCFCCCCCFCCCFCAmCCCFCCCCCGCCCACCCGCCCCCCCCCFCCCCCCCCCCCCCCCCCCCDmCACCCFCCCACFCCCCCCCFCCCCCACFCCCDmCCCCCFCCCCCCCCCACCFCCACCCFCCCCACCCCCCCCCCGCCCACCCCGmCCACCCCCACFCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCGCACFCCCCCFCCCCGCCACCCCCCCFCCCCCCGCACCCCCCCFCCCCGCCACCCCCCCFCCCGCCCACCCCCCCFCCCGCCCACCCCCCCFCCCGCCCCCACCCCCFCCCCGCCACCCCCCCCFCCCCFCACFCCCFCACFCCCCDmCCCCFCCCCCCCCCCCCFCCCCCCCCCCCCFCCCCCFCCDmCCCACCCCCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
F# E B G# D#m G#m C# G D# C C#m] Chords for Rocket Rockers HD LIVE - Reaksi Rasa - Bersama Taklukkan Dunia with song key, BPM, capo transposer, play along with guitar, piano, ukulele & mandolin.Ditulis oleh Jasmine pada Mar, 11 2021 Ditulis oleh Jasmine pada Mar, 11 2021 Original Artikel © // Taklukan Dunia" lagu ini bercerita tentang sebuah bersahabtan yang selamanya akan bersama menghadapi duniaC G Am Gteringat kembali satu permainanF C Dm Gyang sering dirimu dan aku mainkanC G Am Graihlah tanganku, genggam jabat eratF C Dm Gmenari bersama, tertawa ceriaAm Gdan ku kembali demi masa laluDm Gkawan sejati takkan pernah pergiReff C G Amjangan ragu kawanku tuk singgahi tempat iniF G Cmenyanyikan lagu kesenangan sepenuh hatiC G Amberdua kita lewati jalan yang terjal berlubangF G Cbersama kita taklukkan duniahari-hari bahagia, senyum lepas dan tawaobati luka lama yang menyiksait's okay tuk berbeda, jangan lelah mencobabuka mata, dengar rasaberpegangan terbang tinggi,tuk menyapa sang pelangigapai semua mimpi-mimpi,jangan tertidur kembaliAm Gdan ku kembali demi masa laluDm Gkawan sejati takkan pernah pergiReff C G Amjangan ragu kawanku tuk singgahi tempat iniF G Cmenyanyikan lagu kesenangan sepenuh hatiC G Amberdua kita lewati jalan yang terjal berlubangF G Cbersama kita taklukkan duniaReff C G Amjangan ragu kawanku tuk singgahi tempat iniF G Cmenyanyikan lagu kesenangan sepenuh hatiC G Amberdua kita lewati jalan yang terjal berlubangF G Cbersama kita taklukkan duniaLagu "Bersama Taklukan Dunia" dari Rocket Rockers ini dipublikasikan pada tanggal 21 Mei 2015Dokumen dari situs © chordquOriginal Artikel © // GC D G terlintas keinginan tuk dapat G C D G hilang ingatan agar semua terlupakan G C D G dan ku berlari sekencang-kencangnya G C D Em tuk melupakanmu yang tlah berpaling C Em C D yang tlah berpaling Reff : G C Am disini kembali kau hadirkan C D Em ingatan yang seharusnya kulupakan D C dan kuhancurkan adanya
Bersama Taklukan Dunia" lagu ini bercerita tentang sebuah bersahabtan yang selamanya akan bersama menghadapi dunia C G Am G teringat kembali satu permainan F C Dm G yang sering dirimu dan aku mainkan C G Am G raihlah tanganku, genggam jabat erat